ID: 1178440413_1178440427

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1178440413 1178440427
Species Human (GRCh38) Human (GRCh38)
Location 21:32593827-32593849 21:32593874-32593896
Sequence CCCAAAGGCCCTGTGCACAGAGC CCCACCGCCCCCCGCCGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!