ID: 1178500517_1178500524

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1178500517 1178500524
Species Human (GRCh38) Human (GRCh38)
Location 21:33122153-33122175 21:33122182-33122204
Sequence CCAATCCCCACAAGAAGAATTTA CCCACTCATCTTTTCAAGTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!