ID: 1178513837_1178513843

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1178513837 1178513843
Species Human (GRCh38) Human (GRCh38)
Location 21:33229905-33229927 21:33229936-33229958
Sequence CCGCGCCGGCGGCGGCGCGGCGC CCGTATCGCTCCTCGTAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 74, 4: 444} {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!