ID: 1178535035_1178535046

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1178535035 1178535046
Species Human (GRCh38) Human (GRCh38)
Location 21:33403790-33403812 21:33403817-33403839
Sequence CCTGCGGGTGCCCCAGGTGGGGG GCGGGGTGCCCAGGGCTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!