ID: 1178574782_1178574788

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1178574782 1178574788
Species Human (GRCh38) Human (GRCh38)
Location 21:33776291-33776313 21:33776306-33776328
Sequence CCTGTAAACCCAATACTTTGAGA CTTTGAGAGGGCAAGGTAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 432, 3: 7935, 4: 68496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!