ID: 1178668481_1178668487

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1178668481 1178668487
Species Human (GRCh38) Human (GRCh38)
Location 21:34569545-34569567 21:34569561-34569583
Sequence CCTTCCTCCACCTGCCTACCCTG TACCCTGGAGTCACTGCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 838} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!