ID: 1178680536_1178680542

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1178680536 1178680542
Species Human (GRCh38) Human (GRCh38)
Location 21:34669642-34669664 21:34669662-34669684
Sequence CCGAGGAGGGAGCCCCGGAGGGT GGTGCCGAGGTGCCCCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 224} {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!