ID: 1178686803_1178686807

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1178686803 1178686807
Species Human (GRCh38) Human (GRCh38)
Location 21:34718274-34718296 21:34718295-34718317
Sequence CCATTCTCCATTTAGGTTTCAAG AGAAATAAAATGAATGGTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 241} {0: 1, 1: 0, 2: 4, 3: 77, 4: 761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!