ID: 1178686803_1178686811

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1178686803 1178686811
Species Human (GRCh38) Human (GRCh38)
Location 21:34718274-34718296 21:34718325-34718347
Sequence CCATTCTCCATTTAGGTTTCAAG TAAAATGGTGAGGACAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 241} {0: 1, 1: 0, 2: 3, 3: 64, 4: 623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!