ID: 1178728693_1178728704

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1178728693 1178728704
Species Human (GRCh38) Human (GRCh38)
Location 21:35079005-35079027 21:35079042-35079064
Sequence CCAGCCCATGTCTTGGCATGGCA GGCATCTACTCTGGGCTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 194} {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!