ID: 1178743463_1178743465

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1178743463 1178743465
Species Human (GRCh38) Human (GRCh38)
Location 21:35225006-35225028 21:35225029-35225051
Sequence CCAGCTCATTGCCATTTAGGGGA GTCTGAAAGACGAGCACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80} {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!