ID: 1178751253_1178751257

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1178751253 1178751257
Species Human (GRCh38) Human (GRCh38)
Location 21:35305627-35305649 21:35305641-35305663
Sequence CCTCTTTTCCACGTAGCTTTAGC AGCTTTAGCCACAGGGACGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!