ID: 1178788011_1178788018

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1178788011 1178788018
Species Human (GRCh38) Human (GRCh38)
Location 21:35672464-35672486 21:35672517-35672539
Sequence CCATTTTGCCAGTATAACTACAG ACCATGCTGCAACCTACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126} {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!