ID: 1178808372_1178808375

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1178808372 1178808375
Species Human (GRCh38) Human (GRCh38)
Location 21:35858623-35858645 21:35858671-35858693
Sequence CCTAATATAAGCACTCCATTCTG CCTCCTCAAATCAGTCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150} {0: 1, 1: 0, 2: 0, 3: 31, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!