ID: 1178819048_1178819056 |
View in Genome Browser |
Spacer: 15 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1178819048 | 1178819056 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:35958683-35958705 | 21:35958721-35958743 |
| Sequence | CCCACAGAGGTCACAATGCCCTT | CATGGTTGGATAACTTATGCAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 1, 3: 6, 4: 144} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||