ID: 1178820027_1178820032

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1178820027 1178820032
Species Human (GRCh38) Human (GRCh38)
Location 21:35966606-35966628 21:35966651-35966673
Sequence CCCTGGACAGTAGAGCCTTGGGC CACTGACAAGTGCAATCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112} {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!