ID: 1178820029_1178820033

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1178820029 1178820033
Species Human (GRCh38) Human (GRCh38)
Location 21:35966621-35966643 21:35966658-35966680
Sequence CCTTGGGCACACGTTTACGTGCT AAGTGCAATCCTGGGGAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!