ID: 1178824720_1178824724

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1178824720 1178824724
Species Human (GRCh38) Human (GRCh38)
Location 21:36005296-36005318 21:36005311-36005333
Sequence CCTGCCCCGTGCTCATTTGGGGC TTTGGGGCTGACGCCATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 40, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!