ID: 1178831462_1178831471

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1178831462 1178831471
Species Human (GRCh38) Human (GRCh38)
Location 21:36060354-36060376 21:36060384-36060406
Sequence CCGGCGGCCGCTTCCAAGATGGA GTGGGCGGGCCCAAGGCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83} {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!