|
Left Crispr |
Right Crispr |
| Crispr ID |
1178992442 |
1178992449 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
21:37366990-37367012
|
21:37367036-37367058
|
| Sequence |
CCGCCGCCGCTTCTGCTGCTGCT |
CGCTGCCGCCGCCGGCGAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 77, 3: 357, 4: 1187} |
{0: 1, 1: 0, 2: 5, 3: 50, 4: 306} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|