ID: 1178997705_1178997710

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1178997705 1178997710
Species Human (GRCh38) Human (GRCh38)
Location 21:37420336-37420358 21:37420363-37420385
Sequence CCCACCCCATCAGGATGATATGA TGAAAGAAGACGATGCATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150} {0: 1, 1: 0, 2: 1, 3: 12, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!