ID: 1179106532_1179106538

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1179106532 1179106538
Species Human (GRCh38) Human (GRCh38)
Location 21:38405490-38405512 21:38405508-38405530
Sequence CCCTGGGAGAGTCTGCTTCAATT CAATTAGGCTGGAGGGCAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 219, 4: 1810}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!