ID: 1179144234_1179144242

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179144234 1179144242
Species Human (GRCh38) Human (GRCh38)
Location 21:38753054-38753076 21:38753083-38753105
Sequence CCGCCAGGGGTGGGTACGCTTTC GCCCCCATGGGGAGGCAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!