ID: 1179150216_1179150226

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1179150216 1179150226
Species Human (GRCh38) Human (GRCh38)
Location 21:38803538-38803560 21:38803574-38803596
Sequence CCAGGGCAAGGGGGCTGCTTGGG CTTTGGAAGGGGAAATAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 504} {0: 1, 1: 0, 2: 5, 3: 56, 4: 1184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!