ID: 1179153218_1179153220

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1179153218 1179153220
Species Human (GRCh38) Human (GRCh38)
Location 21:38827357-38827379 21:38827376-38827398
Sequence CCTTGTAAAAATAGTCTTAACCT ACCTTGAGGATCCTTCTGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!