ID: 1179154483_1179154496 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1179154483 | 1179154496 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 21:38838257-38838279 | 21:38838297-38838319 |
| Sequence | CCATGCTCCAACTGTCTCTGCAG | GAACATCAAGGAAGGCTCTCTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 4, 3: 34, 4: 236} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||