ID: 1179197943_1179197950

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179197943 1179197950
Species Human (GRCh38) Human (GRCh38)
Location 21:39183388-39183410 21:39183417-39183439
Sequence CCGCCCCGTGACCGGCTGGACAC AGCGCCGCGGGACCGCACGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57} {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!