ID: 1179209278_1179209295

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1179209278 1179209295
Species Human (GRCh38) Human (GRCh38)
Location 21:39312727-39312749 21:39312762-39312784
Sequence CCCCAGTGCGGGTCACACTTTGC GGGGTCCCCGCGAGGGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106} {0: 1, 1: 0, 2: 1, 3: 24, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!