ID: 1179209278_1179209296

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1179209278 1179209296
Species Human (GRCh38) Human (GRCh38)
Location 21:39312727-39312749 21:39312765-39312787
Sequence CCCCAGTGCGGGTCACACTTTGC GTCCCCGCGAGGGGAAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106} {0: 1, 1: 0, 2: 2, 3: 28, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!