ID: 1179218114_1179218119

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1179218114 1179218119
Species Human (GRCh38) Human (GRCh38)
Location 21:39384553-39384575 21:39384589-39384611
Sequence CCTGGCCGACAATTTTTTTTTTT AAGTTCAGGGATACATGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 268, 3: 1489, 4: 8204} {0: 88, 1: 1371, 2: 3301, 3: 4038, 4: 3547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!