ID: 1179225075_1179225090

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1179225075 1179225090
Species Human (GRCh38) Human (GRCh38)
Location 21:39445799-39445821 21:39445848-39445870
Sequence CCTCCTGGGAAGCGCCGGCCTGC CGGGCAGCAGGAGCCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 148} {0: 1, 1: 1, 2: 5, 3: 56, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!