ID: 1179225077_1179225085

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1179225077 1179225085
Species Human (GRCh38) Human (GRCh38)
Location 21:39445802-39445824 21:39445828-39445850
Sequence CCTGGGAAGCGCCGGCCTGCGGG TGGGCGCGCGCATGCGCACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171} {0: 1, 1: 0, 2: 1, 3: 11, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!