ID: 1179334627_1179334633

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1179334627 1179334633
Species Human (GRCh38) Human (GRCh38)
Location 21:40439057-40439079 21:40439090-40439112
Sequence CCTGTTTACCACCCATTAGCTGT GCAAATTGCTGAACCTCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113} {0: 1, 1: 6, 2: 42, 3: 303, 4: 1015}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!