ID: 1179358274_1179358277

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1179358274 1179358277
Species Human (GRCh38) Human (GRCh38)
Location 21:40682274-40682296 21:40682292-40682314
Sequence CCCTGGAAGATGATGAAATGACC TGACCAATACAGAAAGTGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!