ID: 1179404088_1179404100

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1179404088 1179404100
Species Human (GRCh38) Human (GRCh38)
Location 21:41111161-41111183 21:41111200-41111222
Sequence CCCTATGAAGATGTAACGAGAGC GGGTTTAAGCAGAGGGAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!