ID: 1179451791_1179451801

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1179451791 1179451801
Species Human (GRCh38) Human (GRCh38)
Location 21:41473212-41473234 21:41473249-41473271
Sequence CCCATTTAAACACAAGGATGCCG GAGACCTGCTCAAGGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 3, 2: 45, 3: 221, 4: 770}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!