ID: 1179455198_1179455205

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1179455198 1179455205
Species Human (GRCh38) Human (GRCh38)
Location 21:41494470-41494492 21:41494492-41494514
Sequence CCGGATGCACCTCGTAGACAGTG GGGGACCACAGTGGGCTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43} {0: 1, 1: 0, 2: 5, 3: 42, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!