ID: 1179458247_1179458255

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1179458247 1179458255
Species Human (GRCh38) Human (GRCh38)
Location 21:41514528-41514550 21:41514571-41514593
Sequence CCTTCACCTTAGAAAAGGCAACT GACCCCTAGAAATTTCACTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 25, 2: 176, 3: 231, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!