ID: 1179480291_1179480303

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1179480291 1179480303
Species Human (GRCh38) Human (GRCh38)
Location 21:41672515-41672537 21:41672544-41672566
Sequence CCAATGAGGCCCTCCTGACCCAA ATGGAGAAACTGAGGCAGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 39, 3: 273, 4: 1502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!