ID: 1179486553_1179486564

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1179486553 1179486564
Species Human (GRCh38) Human (GRCh38)
Location 21:41714180-41714202 21:41714225-41714247
Sequence CCCTTCTACAGCACCGGTGGCAC CCCACTCACAGGAGAGCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!