ID: 1179511763_1179511776

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1179511763 1179511776
Species Human (GRCh38) Human (GRCh38)
Location 21:41878645-41878667 21:41878697-41878719
Sequence CCAAAAGGCTTACGAAAATAAGG GGACTCAGCTTCTCTAAACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 119} {0: 1, 1: 0, 2: 1, 3: 10, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!