ID: 1179525729_1179525734

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1179525729 1179525734
Species Human (GRCh38) Human (GRCh38)
Location 21:41974726-41974748 21:41974751-41974773
Sequence CCCAGGGTTTTGAATGCACATTA ATTTGGGAAGTCCTGTCCTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!