ID: 1179537518_1179537525

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1179537518 1179537525
Species Human (GRCh38) Human (GRCh38)
Location 21:42062016-42062038 21:42062048-42062070
Sequence CCTCAGGACAAATTGGCCTTCCC TCGCGGCAGGCAGAGAATCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!