ID: 1179550927_1179550932

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1179550927 1179550932
Species Human (GRCh38) Human (GRCh38)
Location 21:42143301-42143323 21:42143325-42143347
Sequence CCGGTGCTGTGTTGGGCACGCTG GGAGGCCAGAAACGCATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 20, 4: 173} {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!