ID: 1179557161_1179557173

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1179557161 1179557173
Species Human (GRCh38) Human (GRCh38)
Location 21:42187100-42187122 21:42187131-42187153
Sequence CCAGAGCCTGGGAAGTGTGAGAT TGGCAGGGTCAGGGTCTGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 54, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!