ID: 1179571848_1179571858

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1179571848 1179571858
Species Human (GRCh38) Human (GRCh38)
Location 21:42283174-42283196 21:42283205-42283227
Sequence CCAGCGAGATTTGACAGTAGTGT CCTTCTGAGGGGGGGATGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!