ID: 1179582718_1179582728

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1179582718 1179582728
Species Human (GRCh38) Human (GRCh38)
Location 21:42353595-42353617 21:42353633-42353655
Sequence CCCTCCTCTTTCTGTTTATCCTT CTTCCATTTTGCACACTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 146, 4: 1571} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!