ID: 1179587537_1179587549

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1179587537 1179587549
Species Human (GRCh38) Human (GRCh38)
Location 21:42383278-42383300 21:42383324-42383346
Sequence CCTCTCTCCCCACCCTCACTGCC CTCTAAGACAAGTGCTGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 249, 4: 2002} {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!