ID: 1179587543_1179587549

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1179587543 1179587549
Species Human (GRCh38) Human (GRCh38)
Location 21:42383299-42383321 21:42383324-42383346
Sequence CCCCTGCTCCCAGAGCTCACAGC CTCTAAGACAAGTGCTGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 545} {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!