ID: 1179588425_1179588429

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1179588425 1179588429
Species Human (GRCh38) Human (GRCh38)
Location 21:42388893-42388915 21:42388914-42388936
Sequence CCTTCTGTTTCCCCAGGGGAAGA GAGCCATGACCTTACCACAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 305} {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!